Search Results for 'conserved alignment'
conserved alignment published presentations and documents on DocSlides.
PINALOG Protein Interaction Network Alignment
by sterialo
and its implication in function prediction and com...
Multiple alignment The linear comparison of more than two sequences
by natalia-silvester
Places residues in columns . per . position sp...
Overview of Multiple Sequence Alignment Algorithms
by davis
Yu He. 04/13/2016. Adapted from the multiple seque...
Bacteriophage Gene Functions
by natalia-silvester
Welkin Pope. SEA-PHAGES Bioinformatics Workshop, ...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
